Title Page
초록
Abstract
Contents
1. Introduction 13
2. Materials and Methods 16
1. Vector의 제조 16
2. 세포배양 (Cell culture and culture media) 16
3. Transfection with electroporation 17
4. 세포 수 및 생존율 및 세포 대사물 측정 17
5. hTGF-ß1 생산량 분석 17
3. Result 20
1. Vector의 제조 및 PCR을 통한 검증 20
2. hTGF-ß1 transfection과 sequential selection 23
3. Limit Dilution and Clone selection 26
4. Clone Batch Culture and Analysis 28
4. Conclusion and Discussion 32
Reference 33
Figure. 1. Schematic representation of Cell line development 15
Figure. 2. Graphic representation of the constructs used in this study (A) Schematic of vector... 19
Figure. 3. Plasmid preparation and Enzyme cutting (A) DHFR+1Fw.ATGGTTCGACCATTGAACTGCATC과 wPRE +48 Rv. AAGAATACCAGTCAATCTTTCAC 프라... 22
Figure. 4. Selection of Transfected Cell Growth Curve 24
Figure. 5. Selection of hTGF-ß1 production cell pools 25
Figure. 6. Analysis of parental clones using ELISA assays 27
Figure. 7. Clone batch culture (A) Cell density and viability of clones (B) Glucose concentration in the media (C) Lactate concentration in the media (D) Batch culture titer 30